Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2324
Contig Information
Length 869 bp
Tissue Seed DPA20
Clones 9 Clones [Download: CSV  ,  FASTA ]
whdp10b19    whdp6h13    whdp13j05    whdp17a01    rwhdp10b19    rwhdp6h13    rwhdp13j05    rwhdp16j18    rwhdp17a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit inositol-3-phosphate synthase [Zea mays]
Score 870
Evalue 1.4988e-91
Total Hit Count 427
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2324
TAGCACACATACTACTAATTAACTTACAAAACACGAACAGAGGGAGTGGACTAACTTAGCTAACACGAACCCTCCTCCCTCCACATCATCCAACACCATG
GAGCCCATGAGAAGCTACCAAGTCGCAGAGACCAGACAGAGAGCCGAAATAGTCTCGCAAGGACACACACACACACTACAGGGTAAACTTAAACAAGGGA
AAGAATCGCAAAGGAAACTAAAGACAAGCCGCCAAATAATTGCACAGCCGATCTCGCCTTCTTCTTCCTCCTGCCCTCCCGTCGCCCCCCGCCACTTGCT
ACATACGTACGGTCGCTCTCGGCCCTGCGAGCTTGGGCCATGCTCCTCACTTGTACTCCAGGATCATGTTGTTCTCGGGCGCCAGGCCGACGCAGGCCCT
CATGATGTTCTCCAGCATCGCCCTCTGCTTCGCCAGGGCGTTCACCACCGGTGTGCCAGGAGGAACCAGGGGTGCCTTGGTGAGGTAGCTCAGGATGGTG
GCAACCGGATGGAAGGAGTGGAACTTGTCCTCTCCCTCGGCTTTCAGCTGAATCCTGGTGCTGAGCTCGGCCAGGAGCACCAGGTCAAGGATGATGGGTG
CGGCGAGGAGCGAGTCCTCGCAGGTGTTGTGCAGCACGATGGTGCTCTTGCCCCCCATGAAGATCTCCGAGGTGTACTCGTCCATGGCCCTCTTGCTGTC
TCCAACGTATGGCACATACTTGATCACGACGACGTGGTCAGGATGCTCCCCGGGCTCGTAGAGGATAGCATTGCTCGAGACCATGTCATCCACCACGTTG
CTCTTGGAGATCTCCTTGGAACGGAATGTCTGCGGTGCGGATAGGTTCATCCCGTCGTTGTCCCCAGAT
page-top