Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2321
Contig Information
Length 1204 bp
Tissue Seed DPA20
Clones 8 Clones [Download: CSV  ,  FASTA ]
whdp1k09    whdp6f19    whdp8i12    whdp12g23    rwhdp1k09    rwhdp8j01    rwhdp11g15    rwhdp12g23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 1639
Evalue 1.69231e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2321
AAGAGTCTGGTGAGCATATCATCGCTGGAGCCGGAGAGCTTCATCTTGAAATCTGCTTGAAGGATCTGCAGGATGACTTCATGGGTGGTGCTGAAATCAT
TGTTTCCCCCCCTGTCGTCTCCTTCCGTGAGACTGTTCTGGAGAAGTCCTGCCGTACCGTTATGAGCAAGTCCCCCAACAAGCATAACCGTCTGTACATG
GAAGCTCGCCCATTGGAGGAGGGATTGGCTGAGGCTATTGATGATGGCCGCATTGGCCCGCGTGATGATCCTAAGGTGCGCTCCAAGATCCTGTCTGAGG
AGTTTGGTTGGGACAAGGATCTCGCCAAGAAGATTTGGTGCTTTGGACCTGAGACGACTGGCCCCAACATGGTTGTGGACATGTGTAAGGGAGTGCAGTA
TCTGAATGAAATCAAGGACTCTGTTGTGGCTGGGTTCCAGTGGGCATCGAAAGAAGGTGCTCTGGCTGAGGAGAACATGCGTGGCATTTGCTTTGAGGTC
TGTGATGTTGTTCTGCACACTGATGCTATTCACAGGGGTGGTGGTCAGGTCATCCCAACAGCCAGGAGGGTCATTTACGCTTCTCAGCTCACTGCTAAGC
CAAGGCTGCTGGAGCCTGTGTACCTGGTTGAGATCCAGGCCCCGGAGAATGCACTTGGCGGTATCTATGGTGTTCTGAATCAGAAGAGAGGGCACGTGTT
TGAGGAGATGCAGAGGCCTGGTACCCCGCTGTACAACATCAAGGCTTACCTCCCGGTCATCGAGTCGTTCGGGTTCTCAAGTACCCTCAGGGCTGCGACA
TCTGGCCAGGCTTTCCCCCAGTGTGTGTTCGACCATTGGGACATCATGTCTTCTGATCCTTTGGAGGCCGGCTCCCAGTCCGCGACCCTTGTCACAGAGA
TCCGCAAGCGCAAGGGTCTCAAGGAACAGATGACCCCTCTATCTGATTTCGAGGACAAGCTCTAAACTTTTGCTTCTGTTACATGGTCTAGTTTGCTTTT
GCTGCTAAGAGAGCTGCACTATTATCTGTCTATTGAGTCGTCGTCGCTGTATTGCTATTGGAATGTACTCCTATCTGTCGTGATACTGGCACTTTGTTTT
GATGTCTGTCGATGTTAAAACTTAGATTATATATCTGTCGCGATACTTTTGATGTCTATCAATGTTAAAACTTANACTATATATCTGTTATGGTAAAAAA
AAAA
page-top