Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2310
Contig Information
Length 821 bp
Tissue Seed DPA20
Clones 8 Clones [Download: CSV  ,  FASTA ]
whdp1n23    whdp8o23    whdp11m03    whdp16m06    rwhdp1n23    rwhdp8o23    rwhdp11m03    rwhdp16m06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 5.56087e-69
Total Hit Count 401
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2310
ACTCTGCATAAGCAACATCCAACAGAACAAACACGATATGATATTTAAGGTATCTCATACGCGGCACACAGATATTGCACAGAAAACAGTTCTGAACTTC
AGATGCTCCAAAATCAGGCTAACCCTTCATGATACCAGAAAGCTAAAGCTTCATGTCAGACCTTCACTTCTTGGCCTTGGCCTTCTTTGGTGCCGCTGCT
GCCGGAGCTGGAGCTGGAGCTGCAGCCGCTGGTGCTGGTGCATGATCTCTGGGGCCCTGAGCCAATCTCTCCTCCCTCCTGGCATGCTTCCTCTCCCTGC
TTGCCTTGCTCTTGGCGCGCTTGGCCTCAAACTGATCAGAGAGGGTCTTCTCTCTTGCCTTCTCAGCCTTGGACTTGTGGATACTCTCCATGAGGACCCT
CTTGTTCTTGAACATGTTACCCTTGACCTTCAGGTACATGTCATGGTACATGTGCTTGTCGATCTTCTTGGCCTCACGGTACTTGCGCAGAAGGCGCCTC
AGGACGCGCATCCTCCGCATCCACAGGATCTTGGTGGGGAGCCTAGCCTCCCTGGTACCCCTACGCTTACCATATCCAGAGTGACGGCCCTTCTGCTTGG
CCTCATGTGCCCTCCTTGCACGAGACCTGGAGTGGATCTTCTGAGGCTTCCTGATGATGAAACCATCCTTTACCAGCTTCCGGATGTTCTGCCGGGAGTT
GGCCATGGAGATCTCGTTGACCTCATTGGGGTCGAGCCAGACCTTGCCCTTGCCACACTTGAGGACGCTCGAGGCCAGGCGCTTCTGCAGCTTCAGCGAC
ACCATCTTCGCCGCCGCTCTC
page-top