Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2304
Contig Information
Length 851 bp
Tissue Seed DPA20
Clones 8 Clones [Download: CSV  ,  FASTA ]
whdp10c04    whdp4f20    whdp5o08    whdp12p24    rwhdp10c04    rwhdp4f20    rwhdp5o08    rwhdp12p24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit arachidonic acid-induced DEA1 [Capsicum chinense]
Score 234
Evalue 8.16542e-18
Total Hit Count 273
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2304
TTTTTTTTTTATAGTAATAATGGAAAATAGCAAATCTTTTATTTAGTCGGAGATAGCGGTACATCATGAGCACTCTGGCAATAACCAACTCATCACAAAC
ATGTGACGATTACGACAACACATCATGCACACACACACAACGAAATCCTTACGCACGCAGGTAACAGTGCGTGCTTGTACGTACGTAGAACCTGGAGAAG
TAGTACGTAGTTTCTCCGCAATCGAAATCCAGCCACACATAAAAACCAGCAGATGATTAAGAAATTAAAGCACACAACAAGTACGTAGTGGTACTTCAAA
TAGCCAGTCATGCATGCATGCGTGCGTGCATGAGGTATGGCGGATGCAGGGTCCGGCCGGCTCAGTTGGGGCACTGGAAGCCGGAGGGGACGTTCTTGCC
GCAGTTGTTGAGGACGAGGCTGAGGGCGATGGGCAAGGTCAGGTTGATGCCCAGAAGGTTGAGGTTCAGCGTCGTGCAGAGGCACAGCGCCGCCTCGAGG
TCCGCCAGCCCCTGGATCAGCGAGCAGCACGGCTGCACCGGCGGGCTCCCCAGGGTAAGGTTCAGCAGCCCGAGCACGTTCGCGCACACCCCCAGCTTCA
GCGCGTCCAGAGGGCACTGGGTGCTGTTTCCGCCCCCACCGTTGCCGCCGCCACCATTGCCACCGCCACCGTTTCCGCCGCCACCATTCCCACCGCCACC
GTTTCTTTGGTCGTTCGCGGGCCTTCTACATATTTGTATGTTTCCACTCTTTCGTGATTTCAGCTCATTTGGTGTAAAAGTTTGCCTTCGATTTGATGTA
CTCCTCGTGTCCGGTTCTGTATTAGTACGAGGCTATGGTCCATATACTTTG
page-top