Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2301
Contig Information
Length 708 bp
Tissue Seed DPA20
Clones 8 Clones [Download: CSV  ,  FASTA ]
whdp10c24    whdp12d12    whdp13h02    whdp18k24    rwhdp10c24    rwhdp12d12    rwhdp13h02    rwhdp18k24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Type-5 thionin; Contains: RecName: Full=Type-5 thionin; AltName: Full=Type V thionin; Contains: RecName: Full=Acidic protein; Flags: Precursor >gi|21885|emb|CAA43844.1| wheat type V thionin [Triticum aestivum] >gi|21887|emb|CAA43845.1| wheat type V thionin [Triticum aestivum]
Score 594
Evalue 1.0295e-59
Total Hit Count 98
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2301
TAGAGTTTTATATCCATAGGAAAAGGATACAACATATATTATTATATCTCAGTCATGGCAGTACATCAAGCAGGCATCAATATGACATCCACCATGATAT
CTTTTATTGGAGCAACGAAAGAAAATACACACAAGCACATAAACAAACTGACACACTGGTTTGGATACTCTCAATGGGATCCTGTTTTATTGAACACGAT
GGTGAGACATAACTTTGACCTGTGAAATCTAAGACCAAGCATATGCATTATTAGTCATCAAGGGATGCCAAGAGAGTATCCCCCTTACAGAAACTGTCAC
AAGCAACACCGCAGCGTTTCACATAGAGTTTCATCTCTTCAGTACTGTTGTCAGCTGTGTTGATCATGTTGTCACACACGGAAGACCTACATCCCAAGCT
GCAATACTCAATGGCGTTTGGTTCATCGGAGCTGCGTACAGAGGCCAGGCCCGCGGGGAGTCGACAAGCACAGAAGTCTGCGCACTGGAACACTGTACTA
GGACCGAGAAGGCAAGAGTTGAAGCAGGCCACTTTGAAGGGGTTTGCGCCGCAGTCCACGCCCTCTACTTGCACCTGCTCCAGGACCAGCCCCAGCACCA
GTAGGCACACGATCGCACTCTCCAGACCCTTTTGGCCTCCTCCCATGGCTATGGTTGCCGGGCTCTCTTGCAGAAGGCACAAGTATTAATGGGGGCTTCT
GGTTGAAG
page-top