Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs9e14
Contig Information
Length 758 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs9e14   
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 731
Evalue 3.45053e-80
Total Hit Count 332
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs9e14
ATAATATACTCTAAGCAACAATAGAACAGATATCACAAATGGGGGAAAGGGGAGAAAANAAATCACAATGTACGCTGCTGCAGGTTTCGTACACAGTGGT
TCTCANCAGCATGGGCGGCTAACCAAAGGGGCAACAATTAATTTAGATANACTCCTCCCGTCTTCATCTACAACCAAAAAAATCCCATCTAACCCCCTCT
GGTATTTACACNANGGGGGCAGATACTCTTGAGCGCCGATGATCCGATCANCAGTTGACGCCGCACTGCCCCATGGCGACGGCCTTCTGGGTGTCGGATA
TGAACGGGTCGATCTTCACCCACAGGAGGGAGAAGATGGAGGCGAGGAGGATGGACCAGACGATGACGATGGTCGGCGTGCGGTTCTGCTTTCCCATGAN
ACCCTTGAGGAAGGGGTAGAGATGGAGGATCACCCAGATCGAGAAGAANAGCTTTCCNAANAGCGGGCCCCANGATTGGTANCCGCTGTTGATGGCGTAT
GATATGCCGGCCACCATGCCCACAAGGTTGATGACCANGACGGTGGTCGGAGGGATCAGGAGACTGGTCCACTTGAACACGTATANCTCGGNGAAGTCGC
CGTCCTCGTCGTTCGCCTTGGATGTGACAGNGAAGTTGGTGTCGATCCCGGCCAGCACCTTGAGCAGACCCTGGAACACCGCGAAAAGATGGGCCANATG
TGCCACCGATAACCCAGAACTGCTCGTTTCTCCACCAANNCCTCGATGCCGACACCAC
page-top