Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2292
Contig Information
Length 1053 bp
Tissue Seed DPA20
Clones 8 Clones [Download: CSV  ,  FASTA ]
whdp3j07    whdp3l03    whdp8e11    whdp9g10    rwhdp3j07    rwhdp3l03    rwhdp8e11    rwhdp9g10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit seed maturation protein [Zea mays]
Score 1023
Evalue 3.73538e-109
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2292
TTTTTTTTTTAGGCACTAGAACAGGTAATGCCATAACATTTCTGGCTCCCGGATAGAGTAACCATGGCTGAAAGTTGGAAAATAAACAAAAAAATGAAGA
TCAACAATCTTCAGCCGGAAACTCCACAAAAAGATCAGCACACCACATCTATATGTACTATCAAAGTAGTATTAACTAAAGACAGACGCAATGACACAGA
ACCATCCTTCAAAATGAGGCGACAAGTTGAGGGTAACACAGATGGCAATACGCGGCAGGGTAACTCTTGTGATCTAGTGCTTCTTGTTCTTCGGGATCTT
CGACAGGACCTTCTCTTCAAAGATGGCATAATACTTCTTCAATTCGATCATGGCCTTCTCACCAAAAGCATCAACCTTGTCATCGTACTTCTCATACAGA
ACTGGCACAGTGTACAGCACCACAAAGACTATATATGACAATGTCAAAAAGTTGCAGTAGCTCCCAAGAACAGAAAGAAGCCAGAGCCCTCCAATCACAA
TGAGGAATTTCTTCAGATCACGACCATGACCAGTCTCTCTCAAGGTAAAGAAGCCCCGGTTGATCTCATGCCGCAGTGATAGTGCAATGTTTACAGTCAT
GTCCTCCGGGATTTTCACCTCAGGGATGTTCGGGGGAGACTTGTGGATGAAAATGCAGACATTGGAATAGAGGAAGAGGGTTGCCAGGGAGAGGATGAGG
CAGTGGCCCACCAAGGTGAGCAGATGGTACTCCATGACCTCGAACAGCAGCCAGATGGCAGTAGCGCCAGCAAGCACCCCTCCGGAGACCTTCTTGTTCC
TCCATAGAACAAGATCAGCAGGCTTGCCGCCGCCGAGGACGGCGTGGACGGGCTTCTCGCGGCCGAAGAGGCGGTAGATCTTGGCCTTGACGCCCGCCGC
CGACCCCTTCTTCTCGTCGTCCGAGTCCGAGGACGACGACGACGAGTCCCCACCGTGGAACTTGTCGGAGATCTTGTCCATCATGGACTCCGCCACCGGC
TCCTCCTTGTGCTCCGCCATGCTCCCTAGTCCCCCCACGCTCTCCTCCCGAGC
page-top