Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2289
Contig Information
Length 954 bp
Tissue Seed DPA20
Clones 8 Clones [Download: CSV  ,  FASTA ]
whdp11n15    whdp12l04    rwhdp10d14    rwhdp4b09    rwhdp11n15    rwhdp11n16    rwhdp12l04    rwhdp13j03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0701100 [Oryza sativa (japonica cultivar-group)] >gi|97536398|sp|P35683|IF4A1_ORYSJ RecName: Full=Eukaryotic initiation factor 4A-1; Short=eIF-4A-1; AltName: Full=ATP-dependent RNA helicase eIF4A-1; AltName: Full=DEAD-box ATP-dependent RNA helicase 4 >gi|53791892|dbj|BAD54014.1| eukaryotic initiation factor 4A [Oryza sativa Japonica Group] >gi|53792733|dbj|BAD53769.1| eukaryotic initiation factor 4A [Oryza sativa Japonica Group] >gi|113596521|dbj|BAF20395.1| Os06g0701100 [Oryza sativa (japonica cultivar-group)] >gi|125598400|gb|EAZ38180.1| hypothetical protein OsJ_021663 [Oryza sativa (japonica cultivar-group)] >gi|215712230|dbj|BAG94357.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215740601|dbj|BAG97257.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767366|dbj|BAG99594.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1006
Evalue 2.9738e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2289
GTACCGATTGCAGGATTACATGCGGTAGGTAAAGAGTCAAGGATGACACAAACAAATAACATCATTCGGTCATTACATAGTCTTAACAAATAAAGTGAGG
ACTCCAGCAACAGCAACATGAGCAGCAGCGCCTCCCTCCTCAGCACATAGAACCACAGCCTAGCAACTACAAAAATTCCCAAAACATGGCTTAATAAATC
CCAAATTGTCCACGACCACGACTTTAAAGTAGAACCCCAGCAGACCATTTATCACTTGAACCCCCCCACCCACAGACAAGAAAGTTTGGTGATACTTCAA
CAAAAACAAAGCCCTGTCAGGACCCCCTTACCATATGTTCTCGACAGCCCGCCCGATCACAGAAGGTCGGCAACGTTGGCTGGGAGCTCTTCAATCACCA
CGTTGTAGAACTTCTGGATGTCAAACAGCATCCTCTCATCTTCACGGGTCACAAAGTTGATGGCCACACCCTTCCTCCCGAACCGACCACTACGCCCGAT
GCGATGCAGGTAGTTCTCTGGCTGGGTTGGGAGGTCATAGTTGATGACAAGGGACACTTGCTGGACATCAATACCACGAGCAAGCAGGTCAGTGGTGATG
AGCACACGTGAAGAACCTGATCTGAACTCCCTCATGATGATGTCCCTAGTGTTCTGGTCCATGTCTCCGTGAGTGGCGGAGACGGTGTGGTCCCTGCCCC
TCATCTTGTCGGTGAGCCAGTCCACCTTGCGGCGGGTGTTCACAAAGATGACACTCTGGGTGATGGCAAGAGTCTCGTACAGGTCACACAGTGTGTCGAG
CTTCCACTCTTCCTTCTCCACATTGACATAGAACTGCTTGATACCCTCAAGGGTGAGCTCATCCCTCTTGACAAGGATCCTCACTGGCTTGTTCATGAAC
TTGCGGGTAATCTCAAGGGCTTCAGGGGGCATGGTAGCAGAGAAGACACCAACT
page-top