Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvs7b13
Contig Information
Length 565 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs7b13   
Homology (BLAST) Top Hit hypothetical protein OsI_08737 [Oryza sativa Indica Group]
Score 431
Evalue 4.89694e-41
Total Hit Count 44
Registered year 2003
Contig Sequence     [ Download ]
>whvs7b13
GTCACAGCAGCATCCGTCGCCACTAATTAATTGCAGCTGTAGCACCGCCCGCCCGCTCCGATGGAGCTTACAAGCCACCAGCGAGGAGAGTCGAGGCGCG
CACGTGGGTGGGTCTGCGCGCGCCGTCCGTCGTCGTCGTCCTCCTAGATCCAACAGCCTTTGTCCCTGCTCGGAGCCGTGCGCCGGGCGGAGGGACGCGC
GACGATGGCCACCGGCCGTGGGCTCCCGCTCCTCCTCGTCCTCGCCGCCCTCCTGGTCGGGCTCGCCTCCGCCTCCCCCTTCATCTCCGACGGCGTGTTC
CAGGCGGGCGCCGGATCTACTACGGGGAGGACCTTGCTGCAGGCCAAGAGGGATTGTCCTGTGAACTTCGAGTTCCAAAACTACACCGTCATCACAAGCA
GGTGCAAAGGGCCAAAATATCCTCCTAAAGACTGCTGTGATTCTTTCAAGGAATTTGCATGCCCATTTAATAACTACATCAATGATGAAAGCAATGACTG
TGCATCCACAATGTTCANCTACATCAACCTCTATGGCAAGTACCCACCAGGCCTGTTTGCCCACG
page-top