Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2268
Contig Information
Length 1164 bp
Tissue Seed DPA20
Clones 7 Clones [Download: CSV  ,  FASTA ]
whdp10c17    whdp6g23    whdp19b17    rwhdp10c17    rwhdp6g23    rwhdp6p23    rwhdp19b17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0525D09.11 [Oryza sativa (indica cultivar-group)] >gi|125548758|gb|EAY94580.1| hypothetical protein OsI_16357 [Oryza sativa Indica Group]
Score 1327
Evalue 2.43593e-144
Total Hit Count 375
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2268
TGGCGTTATTCCTTAAACTCTCCAAGTCACAGACCAATACACCAACAACCCTATCACACTCCGGTATACCATACCATTTCGGCTCAGAAAAGACTAGGAA
CAGGAGGAAAGGAAGTTCGGTATGGTGGTAAAGACAGCATGGGTGTAAGATATACAGAGGTATATTTCTTCAAGCTCAGCCGTCTGTCGGGGAAGAGCTC
AGGGCAGGGAGGCGAAGGAAGGTAGCAGCCAGCCGCGCTCTGTCGCGAGCTCCACATAGCCTCTGAACTTCTCCTGCGCGTTCGGGATGTCAAGGGTCAG
ATCATCGAGGCCTTCCTTGACACGGGCGAAGCCGTTGGTCATCTGGTTGATGGTTATCAGCCCCTCGCTGGAGCACTCCTGCAGCAGAGCCAAGATGCTA
GCTTCATTCTGCTTCTCCATCGCCATCACCAGCGCTTTCTTCACCACTTCATGGTTGAAGAAGGGCATCCCAAGGTCACGGATGCACTGGCAGGCCTCCT
TCAGGTCGCCGCCGGTGTTGTACTCCTCAAGGAGCTTGGAGATCTTGTCTTTTGCATCTTCCACAGCCCAGCCAGTGCCCCCACCCCAGCAGCGCAGTAT
CCTCTCACCAGAATGGCGGGCCGCAAGCAGAGAGCTGGCCATCTGGACAGTTTGACTACCACTGCTGTTTGGCCGCAGCTTGCTACCGATGTCATCCAAA
TTCAGTGGAAGCAAGACTTCATCGATCACTGCCCTGGCGAGGAAGAGGGCGAGTTCACTAGGAGCATCCACAATGTCGAGGGCAGTGTCTTCTGCTGACT
GCAGGAGCATTATGAATCCCTTCATGATATCACCTGCGGAAAATAGTTCCAAGCTGAGTGAAGAAAGAAGTACAGATGCCATCTCCTTCTCCCTGTTCTT
CCTGTCCATAGCAAGCGTGATGAGCTTCTTAAGGAAAATGGCGTTGTATTCAGGGGCAGAAAGCTCTTCAAGGCTTCTAATGAGTTCCGGGACGTCATCT
GAGAGGAAATACTCCTGAATTATGTGACCAGACTCTTCTTTAAAACGCTTGACCTTTTCACTGCTTGCATTCCACATATCTTCATCAGGGGCAGCAGACT
TACAGAATGAAGCATCAAGCCACCCTTCAGACATGGCTGTGGAAAGCAGCTTGTCAAAAAGTGC
page-top