Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2254
Contig Information
Length 1303 bp
Tissue Seed DPA20
Clones 7 Clones [Download: CSV  ,  FASTA ]
whdp7h04    whdp7h15    whdp16p19    rwhdp10d23    rwhdp7h04    rwhdp7h15    rwhdp16p19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38153 [Oryza sativa Indica Group]
Score 1566
Evalue 5.52776e-172
Total Hit Count 421
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2254
TTTTTTTTTTACCACGAAGGAGCCTTTATATGAAAATCTCAGTACAAACAGGGTAATTAAGTACGAGTACAACTCTTTTTTCAGAAAGAAAAACGGTCCA
TATAATCTTTGTATACCCACATGCGGGAATCAATTTCTTCTTGATCTCTACCAACCAAAATATCACACCAATGAAGCGGCCACCTCAGGTCATCTTGCTC
TGGATTTGCCTGTGAACATGCACGAGGAACTCCACATAGGAAAGGCCACCCGGTGCTTTGTCCTCGACCAACAGCGAACGGAAGAAATCTCCAGATGGGT
CGCCCTTTCGGCACAGTCTCAGTCTCAAGTAAGAGCATCTCTGTCGCCTTATTTCATTCACAACTTCATTTACTTTCCTGGACAATGCATGATCAAATTG
CTCCAATGCCAACAGATTTGGTGCACCAGCTAAAGATGAGAAACCAAATATTTGCTCCAGGGTGGCAGGGTTCACCGCATTTCCGACATAAATAAAACCA
TCCTCGCCATTTTCCAATAAATAAATCCCATCATCCTGTATATTCTCACTATTGAGAGTAAGGGGATTTGGAATAAGGGAATCCTCATCGTCCCTTGATG
TAAGATCATGGAGAGCAATCATCCTAGGGAACACCAATGGAATGGCTAATAACACAGAAACTGAGGAGACAGCAGAGACCCAATAGGACCGATCATCTAC
TCTCCCATCATTCCTCAGTCCTATGCTTTTAATCAAGGCCAGAGTATACAAAGGCAGAAGTTTTAAAGCCTCCGGAAGAATTAACTGTCCAGAAGAACTT
ACAGATGCACAATGTTTTCGGTAGGACTGGAGAATATTGATGCAGGTACTTATTACCTGGTCCCTAACTTGGGACAGAGAACTTGATGGAATGCCATTTG
CAGCTTGCTTAACAACATAAGTAAACTGTGCTTCCTGATCAGCATATCGGAAAAGATTGTTGAGCGTGCTTGTGCATGGAAGTGAAATATTTATGACCCT
TATCCTTCTTTGCCCATATACCGTGGTGTAAAGAAGTGCGCACTGAAAACCACATTCTGTGTTCTCCTGAAACTTATCATCATGCTTGAAGGTAACCATT
ATGGTTTTGTCGGAGTCAATAGCAGGCAAATCAATATCAGTAGGAACACGCTTGCAGAAGTTGCCAGAATAGTCTTGAACTTGAAGCCCCTGACTGCACC
TGACACGCATGACAGCCTCAAAACCCTGGGGTTTAGTGATATTCCATCTGAGATCATTGAAGAGTTTGGCTGGATCAGAAACAGCAGAAAATGGGAAGTA
GTA
page-top