Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvs20h03
Contig Information
Length 715 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs20h03   
Homology (BLAST) Top Hit hypothetical protein OsI_01366 [Oryza sativa Indica Group]
Score 1034
Evalue 1.0094e-110
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvs20h03
GTCAGTTTTGTCTGATGTACTGAAACGCAGCAGCTATGATACAGAACCCATGTTGAAGGCATGTGGAATTTCGATAGCTCAGGGCTTTACACAGGTGGCT
GGTAGGGTACTGCAGGCCCCCAAGCTCAAAGCTGGAAATGGTGAAGATATTTTCACAAGGAATGGACGTTGGAATTTCAACAACAAGAGGCTTGCTAGAG
CTTGTGTGGTGGACAGATGGGCAGTTGTAAACTTTTCGGCTAGGTGTAACACCATGAACCTTGTCAATGACCTCATCAAGTGTGGGGGCATGAAGGGCAA
TACAGTAGAAAAACCTCATATTGTAATTGAAGAGAATGGTTCAATGAGACGTGCACCTGCTCCAAAAAGGGTTGAGGATATGTTTGAGCAAGTGAAGTCT
AAGCTTCCTGGGGCTCCGAAGTTTCTCTTGTGTATTCTTGCTGAGAGGAAGAACTCAGATGTTTATGGTCCATGGAAGCGAAAATGCCTTGCTGACTTTG
GGATTGTCACTCAATGTGTGGCCCCAACAAGGGTCAATGACCAATATCTGACAAATGTTCTGCTGAAGATCAATGCAAAACTTGGTGGAATGAACTCACT
ACTACAAATTGAAATGTCCCCAAGTATACCTCTTGTATCAAAGGTCCCAACTCTCATCTTGGGAATGGATGTGTCCCATGGATCCCCTGGACAGTCTGAT
ATACCGTCCATTGCA
page-top