Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1a01
Contig Information
Length 877 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1a01   
Homology (BLAST) Top Hit hypothetical protein OsI_37030 [Oryza sativa Indica Group]
Score 118
Evalue 0.000241798
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1a01
CATCTCTGAATAATCTGTACATGAAAACAACAATTATGTACGAGGAAATTTCCTAAATTATAATTACAAGTACATAGTGCTTCATTGTAAAAGTTAGACA
CTTCAGAAATTGAAGTTTAAAATCATCACATTACCTCTGAACTAATTTTACAAATGAATTAAATAAATCAACTTATAACGTACATACACTGCCAAGCAAG
AGGAGAAATGATTTGAGTCACAAACAGAGAAGGATTAAAGGTGTTGACTGACGACATGAAGTGCCCAAGCGAAAATAGTGCAAAGAATATAGTATACAAG
GAGATATTTTAACTTCTTTTATTCCTCAAGTAAATGCATATGAGAAGCAACTCATGAGTTTTCCATACAATTTTTGGACGAAATAACTAACATCCAGTGA
AAAATAAGGCGAGGAAGCTTTAATACAAAAAGACTTTGTAGATTGAATTTACAATTATTTTGTAGACAAGAAATAAGGGTTACATTTTATCTATTGAATG
ATTAGAAATTGGATTTTTCTAACTATATTGAATCATGTGTTACAATAGTACATGTCAATGCAGATTAATATTTCCAGCTGGTTTAATCTATACAGATGTT
AACAACTGCAGAAACATTATCAACCATAATATATGAAATTAGTGTCACACGGTAATACATTGGATATAATGTTGGCTGTATAAAGCTCTATAAATTGCTA
AGGAAATGCTGAAGAGACAATAAATTAAGGATCAGTACAATGTGAACATGAAAAAAGATACAAGTTCAATTCCCTACAAAATTAAAGGGAAATCAACGGC
AGATCAAATAGTTATATAGTGTAGATCCCNCATATAATCCNTACATGAAACNTTATGAAGCACTACAAAATGATGCG
page-top