Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1a04
Contig Information
Length 851 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1a04   
Homology (BLAST) Top Hit isopentenyl pyrophosphate isomerase [Triticum aestivum] (no hit)
Score 263
Evalue 9.70029e-22
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1a04
ATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTAGTAGGTAC
TTCTGACGATCCTGCCGGTGGAAATTCACGGTCACAGATTTGTCCAGAATCAAATAGCTCTTCACGTCTCTTCAGCCATCGAAGCTCCAACGAGAGAAAC
ATCCATTCGACGGTGCAGCGATAATTGTACTGTAAGCTTCATTTGGGTAATACACGGACCACTTACAGCTGTTCAAGCTACATAAATTATTTCTAACATA
AGACATCTTACATTATGAAGCAGCTGACCACAAGAAATAGGGTCTAAAATGTTCTTACAGGATAATATGATCCTTCCATACAGAGAAATACTTAAATTTA
GTTCAGAATATCATACAAATAAACACAATTTTGAGTGAAGAACATATGTGCAAGATTTGATTATGCTGGACTGCATGTAGTTGTCGAGTACAGATTTGTG
ATGATGTTGTACAATTTCTCTATATTAATGCAAGTAACTTCTGAATGAATTCAAGATAATTTTTGAATGAAATAGGTACTTTGTCAAAGCTTATGTACGG
TTCAGCGGTATGTAAATTATCAATTGTACCTTTGGTCTTTCGAGGGTAGCTCCATGAACGATTTGCGACGGTAGAACGTTGTGCCATGTAGTCGGATCGG
ACGAGGGGTGCGGACAAAGGAGCACACCAGCACACAGGGGGGAGAACCCGGGGCTNNNNCNNNATANCCCCCGNGCGATCTCCCCCCNANACNNNNNNCN
TCTNTNTTNNGGNGGCNGCCNGCCNNGNNANCGCNCCCNNNNNGNNNNNNG
page-top