Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1a17
Contig Information
Length 397 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1a17   
Homology (BLAST) Top Hit expansin EXPB9 [Triticum aestivum]
Score 139
Evalue 2.313e-07
Total Hit Count 90
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1a17
CTTTCTCTCAGGATTGCGTGGTANAAAAACACACAACTTGGTACATCGTCATGCAGCATTAGCTGCAGTTCAATCGTCTCCTCGACGACAAAGCAGAGGA
AGGCAAAAAAAAAAGGAAAAAAGTTACAGGCGGACGGACTACACACNTGATGATACNTCACTAGGGGAATGCAAAAACCAGGGAGGGAACNTCACAGTTT
CGTAAGCTCCTCCTCCTCATCTGACACCGCCTCTCGCAGCACCCGGACGCACNTTCTTTCTTTTCNCGGNATAAAATTCACACACGGAGCAGGTAAATAT
GGNTGTGACTCAGGGGTANTTCACCAGGGAGCGGTACGTGGCCCCGGCCTTCCAGTTGGCGGGGATGACGTTGCTGACNACAAGCTTCCTGCCGGAG
page-top