Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1b13
Contig Information
Length 901 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1b13   
Homology (BLAST) Top Hit hypothetical protein OsJ_010898 [Oryza sativa (japonica cultivar-group)]
Score 1111
Evalue 1.81959e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1b13
TTTTTGCTCGGTATTTCAGATACAGGGTTATTTGAAATATGTAGTATTCATAATCCTAAATCGGCACTTCATCTGTACTTTTATCTTGAACACATCGAGT
CTGTACTGTACAGTATAGTACACCACATAAACAGGTATACACATTTACGTTGTATGTATCGGCTACTCTGGCAGTAACCACTATACGCTAAGCTTGGGAC
GGTAATACACACTCGCAAATTTCTTCGTAATGGAGTCAACACATGCCATCCTTATTCTTTCAGGCGTTGCCGGGTTGTCGAGGGGGAACCAGTCGAGATG
ACCCTCCTCCGCCCTAGCTGCCGCGGTCGCGTCTTTTATCGCAAACAAGACAGCGGAAGCGAGGAAGAACGGTGGCTCTCCTACAGCCTTGGATGAGTGT
ATAGCCCTTGGATTTGGAACACCCTTCAATAGTGAAACCTTGAAACTGAGAGGTATATCATTTACAGAGGGTATTTTGTAAGAGCCAGGACCACAAGTGA
AAAGGTGTCCAGGTCGAATCCACTTGTGGTTGTCATCCCCCCATTTTAGCTCTTCCATGGCAGCCCAACCCAAACCTTGGATGAAAGCTCCTTCAATCTG
ACCAATATCAATTGCTGGATTAATCGAATAGCCGAGATCCATGACAATATCAGCTGTCCTTGTGTGGAAATCCCCAGTTAGGGTGTCAATCTCAACTTCT
GCAAATGCGGCTCCATAGGTGAAATAATTAAATGGACTCCCCTTGCCAGCAATCCAGTCAAACCCGATATCAGGGGTGATATAAAACCCATGAGCANAAA
GATCTACCCGTTCCATGTANCATGCTTGAGCTAACTCAGTGAAGGACTTATGATTCCCCCTACTAANCAATGGGGTTCCATCCGAGCCTTTATTTGCTGA
C
page-top