Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1b14
Contig Information
Length 666 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1b14   
Homology (BLAST) Top Hit expansin EXPA7 [Triticum aestivum]
Score 716
Evalue 6.52688e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1b14
GATTTGAATAGTACATCCGACAATTACAACTGCATGTAGTATGTAGAACAACTATCTGAGGCTTTGCACTAAACTGATATTTTTCCTAATAATCAGCTCT
TTCCTCAGAGGAATGTACAGTAGGGTAGAGATTATATTCCTTTCCTAATAATAATCTTGTTCCTCAGAAGGATATACAGTACTACAACCAACTCATAGGA
TGATTTTTCTTCTTTGAGAAAATTGTAAGTCGCTATCAATAATTCTCTAGAGCAGGAATTGCTTGCCGGTGTATGTTTTGCCAAACTCCCAATCCTTGGG
CACAACGTTGAAATTGGTCATTGTCGTGCCGTCACTCGAGGTGAGCTCAAAGGACACCGGCTGCCCTGTGAGATCTAAGTTGATGTGCCATATCTGGCCC
CAGTTGCGGCCCATGTCGAGCCAGCCAGACTCTGTTCCTTTGATCTTCACTGATCTGACATCGCCAGCGCCGCCGACATTGCTGATTAGGACTGTGAAGA
AGAAGCTCTTCCCGGAGACCGAGAACCGCACGCCGCCTTCACGAAGGCACTTGACGCGGCGGTACTGGATGGGCATGACGCCGGCCTTCCAGAGCGCAAT
CTTCTCGAACGCCTGGATGGGGAGGAGGAAATGGTGGTTGGGCGGGNTGCNNANNCCNNCNNNNNC
page-top