Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1b22
Contig Information
Length 854 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1b22   
Homology (BLAST) Top Hit hypothetical protein OsI_37645 [Oryza sativa Indica Group]
Score 725
Evalue 9.55346e-75
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1b22
GAGGGGGTACCACATTGTATGACAAATAAATGTGCTATCTTCATAACTGGAAGGTAAGAGGAATCAATCACTTTAGATGAAGAACCTGGAACATAAAGAT
TGACAAGATTTGATAATGACGTGAAGGTTCAATACACTACCGTAGAATATTCTTCAGGTTTCAGCCACTTGGACAAGCAACCACAAAGATTAAGCAGAAG
GGGGTATAGCTTTCACTGTTCGAAATATAGATGACCTGACGTAATCTAAATTTGTTAGGTGGCTTCACGAGTCCAAGTTCAGTGTGGCATCTGCCCTGGC
CTCGATATCGTTCTTGCTCCTGACGACGCATCTCTTCTTTGTCTCGTCGTCCAGGTACCCGAGATCTTCAGCCAGTGCAATATGTGCATGCAGCAGCTCT
TCGAGTTTGTCAGCAGGAACTGAACTCTTACCTTTCTCGCATAGTATCTGATGGAGTTCTTCCTTGCCGTGGTTCTCAGAGCTGAAATGATCGTGAATTC
TCATTGCTTCCTGAAATCCAGATATTGTTGGTAGGAACTTGACCACAAACACACTCTGATTGGCTGGTCTTCCCTGGGTTATCTTTGCCTTGTCACATGC
AACACCAATATCTGCAAGTACACCTTCGATTTCTTCTATTGTCACAATCTTTGCTTCAGAGACCTTTGCCTTGTTTGTGATAGAGCTGTTGTGTATCAGG
ACAACTGGAGGCCATACCATCAGATCTCTCTTCATGGCATTTACTTCCTCAGCGGGAACAGACTGATAGGCTTTANAAGTGTCTGGAGCAACATGCCAAT
TCCACCCCATCANAACACAGAGTGCCTTGTGAAAACCTAAAATGCTTTGTTTTC
page-top