Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1c02
Contig Information
Length 523 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1c02   
Homology (BLAST) Top Hit Os12g0514100 [Oryza sativa (japonica cultivar-group)] >gi|113649386|dbj|BAF29898.1| Os12g0514100 [Oryza sativa (japonica cultivar-group)] >gi|125536811|gb|EAY83299.1| hypothetical protein OsI_38508 [Oryza sativa Indica Group] >gi|215768129|dbj|BAH00358.1| unnamed protein product [Oryza sativa Japonica Group]
Score 336
Evalue 4.03363e-30
Total Hit Count 112
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1c02
CCAGATTTAATCTCTACATAACATCATCAGGGTCGAAGTTTGCTACAGGGTACAGATATGATATTGCCTCCCAAACACATGGATAATAAATCTCTGATAA
TGATAGTCTTGTTTTTAGCTCGATATTAAGCCATCCCACCACTAGTAGCCGTCCTGATAATCTGAAACAAGGATGATCCTATGACGACAAAGATGAAGAA
TCCAAGCACGATGGGTCCAACAGGATAGTCATTCCCCTTCTTCACAGTAGTTTCAGGCACTGAGCCCCTCTTTGTAATGTTCTTCTGAAACTTCGCACTC
TTCCTGTCAGCAAGACGCCTTGAAGTAGTCATCCTTGCTTGGCGGGGCAGGGGAGCTCGCCGGAGACGATGTAGGCAGCGGACGGCGTCCGCGGGATCGG
AGCAGGTGCCGGAGGAGGAGTGGGTTTTTTTTTTTTGANNGACAANNGCAACANTTNTCNCAANTAAAATCTTCCCNCAACTAAANGNCTTTTCNNCGGN
NGATACCCAAAAAAAAANCTANC
page-top