Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1c19
Contig Information
Length 779 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1c19   
Homology (BLAST) Top Hit Os06g0589800 [Oryza sativa (japonica cultivar-group)] >gi|50725436|dbj|BAD32908.1| putative receptor-like protein kinase 2 [Oryza sativa Japonica Group] >gi|113596004|dbj|BAF19878.1| Os06g0589800 [Oryza sativa (japonica cultivar-group)] >gi|218198467|gb|EEC80894.1| hypothetical protein OsI_23539 [Oryza sativa Indica Group]
Score 818
Evalue 1.32761e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1c19
AAACGTCATCTGAAACTGTACAAGAAACCCCTAACCAAAGCTAGCTAGGCAATTATCAAAAACCCTACTCCTTTTTCCTTTCAAATATCATCTCCCTCCA
TTTCTCTTGTTGCAGAAGACGCGCCACTGAATCAGCTGCGACACTGCTCTCATCAGGCTTCCTGGCTGCCGGGCTTGATGAGCGGCTGCTGCGACGTCTT
GGCCCACTCCTCCGGCGGGCTCTTCACCTCCTTGAGGAAGGCCACGACCTCCTTCATGGTCGGCCGCTCCGCCGGCGCCGGGTTCACGCAGAAGATGGCG
ATGCCCAGCGTCTGCAGCATCTCCTGGACCAGCTGGTCCGGCATGCCGCGCAGCTTGGGGTCCAGGATGTTCACCGCCGGCTCGTAGCTCCCCATCTTCT
TCTTGGCCCACTCCACGATGTGGAGGCTGTCGCTGACCATCGGCTCGATGGCGCTCCGCCCGCTCAGGATCTCCAGGAGCACCACGCCGTAGCTGTACAC
GTCGCTCTTCTCCGTGATGTTCGCCGTGTAGCCGTACTCTGGAGCAATGTATCCGTAANAACCGGCGATGCGCGACATGGCATGATGATANTTGGGGGAG
TTCATTANCTTGGCCANCCCAAAGTCANCCAAGTANGCCTCATACTTCNAATCAANCANNATGTTGTTGCACTTGACNTCCCGGNGGANTATCNNCNGGA
CNCANNCATGGNGNANATANGANANNNCNTGNNNNNNNNNNANNNNNATNTNNNANNNGNNNNNNANNNNNNGNTNNNG
page-top