Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1d16
Contig Information
Length 510 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1d16   
Homology (BLAST) Top Hit hypothetical protein OsI_35372 [Oryza sativa Indica Group]
Score 748
Evalue 6.21981e-78
Total Hit Count 178
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1d16
TGGCTGAGGCTGAAGAACCCACTGTAAACTCCCTCGGNGACCACTTTGTCGATCTGGATGGTTACTCTTCCGAGGGTNGACTTTCCNAATGTATTTTTGC
TTTTGCACAAGATGTACAACTTCTGCCCTTTTGGGGGGATGTCNAATAACCAAGTGAATCCCTCGTTCCATACCGGGCAGATGCTCTGGTTAACCAGCTT
GGTTTGCCTTGGAGGACCATTTCCTATTTGCAGGCAACAAAATGCATTTGTACTCCCCATTGTCTGTTTTAAATTATTCCCACGTAAGATGGTCACGGTC
AAGCAACCANGCAGGCAATGCANTAAGCTATCANCTCTGTCATGAAAACTGGGAGGACAGGTCTTCATAANCATCTGTAGTACAGGTATGGCCTCNNCTG
AAATAANANACTGGGCCTTANCAATGTCTTCATTCNTCTGGGGCCAANATTCTTTGANCNANCAAANGGTGTCTANCACACTCTCTTGGGCANCCTCNNT
TCCNTCCTTC
page-top