Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1d24
Contig Information
Length 674 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1d24   
Homology (BLAST) Top Hit hypothetical protein OsJ_011347 [Oryza sativa (japonica cultivar-group)]
Score 354
Evalue 6.31458e-32
Total Hit Count 144
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1d24
AACAGGATCTGCAAACAAGAACGTCGGAGTGGTTGCTTCGGGCACTTTGTAGTATTGCACTCGACAGCTGCCGCCAGTGGTCGGGTCTCCGTTCATGTCA
TGGCTGAGAGAGAATGTGGTCAAACGATAAAGACAGCGGCCAGGTCGGGGCATGACTCCCTCTTCCTTGAGCTCCTGATCAGCACTGTCGCCCTCAATGG
AGACGCACTCTATCAGGCAGAATTTGCTCCGGCGCCCCATGTAGACGAGGGTGGCGCTTACATGCCTCTCGGCTGGGTCCTCACTGAGCAGTTTCATCTT
GCCGAGCTTCGACTTAGGGGTGTGGCCAGTGTCGGAGCTGGGCATGTAGCAGAAGTAGAGTTGTCCGAAGGTGTCTGGATCTTTGGAGAGCCCGACAAAG
GCGCCCAGGAGAGGGTCAAAGTGGCCGCGGCCGTGGAAGGGCAGCGCCCATTTGCCTACTTGTTTCCATGAAAGCTTTACCGTGTCAAAGGCAAACGTGT
CCGCAATAGCTTTCTTCGTGGTGCTCACCAGGAAGGACTGGCTGTAGGGGTTCAATGCGTAGGAGGTGACGTTGCGAACCTTGAACGGCTGCTTCGTGAG
AACTTCCCACGACCACCTCACTCTGCCAGATCGATCCGGCGGCACGGGGCTGAGCAGATCCAAAGAGAGTATCT
page-top