Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1e15
Contig Information
Length 777 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1e15   
Homology (BLAST) Top Hit Os06g0104300 [Oryza sativa (japonica cultivar-group)] >gi|6907083|dbj|BAA90610.1| putative Bplo [Oryza sativa Japonica Group] >gi|113594590|dbj|BAF18464.1| Os06g0104300 [Oryza sativa (japonica cultivar-group)] >gi|125553713|gb|EAY99318.1| hypothetical protein OsI_21286 [Oryza sativa Indica Group] >gi|125595758|gb|EAZ35538.1| hypothetical protein OsJ_019021 [Oryza sativa (japonica cultivar-group)] >gi|215734861|dbj|BAG95583.1| unnamed protein product [Oryza sativa Japonica Group]
Score 743
Evalue 6.55218e-77
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1e15
TCATCCTCAAGGTAGCGGCACAGCGCCCCCAATTGCGGGGCCACAAGCAGCAGTAAGTACCACACACAAACAATGCTTGCACACAACTCTGTTAACAGTT
TCGACGAATTCGCCGATACGCAGCAATGGCAGGACCTCCCCACCCAATCGGTGGAGAACCTACATTCTCAATTTCCTAACCCACAAACCGCAGATCTAGC
ACGCACCACTAGCTGGCAATCACTTCAGTTCAGTGTCCGACAACCGAAAACGCTACCAGCGACACCAGGACCGCCAGCAGGTAGCCGCTCTGTCTTACCG
CGGGGGAGACCGAGCTCGACGACGACCCGTGCGGCTTCTGGGCCTTCTGCTTTTCCCTGAGGAGGCCACAGAAGAGGGCGTTGTCCGGTATCACCGACTC
GGTCACGTTGTAGCCTCCGTCAGGGTCCACCACCCGGATGTACGTCTCCTGGCCGAGGTACCACGTGTCCAGATTCTCCGTGCGCACGTTCCAGAACCCC
GGGCTGTCGAGCGACAACAGGACGGCAGTCCATGCTCCGGGGAACACCTGAGTGGTGCAACGGGAAACGCCGTCCCACTTGTTGTACGTAGAACGACTTT
CGTTCTTCCACTCACCATAGTCCATTCCTACGACCCAAAAGGCGTATCCGTCGATGTGGTAGGTCTGAACCTTCGTGTCGTTGTTCTGAAACACNATCTC
CATGAAGTTCTTGTACGTCNAGTTGATGACANAANATCCNATCACTGGCGGTCCGTCANATGGCATGGTTGGGAANT
page-top