Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1f01
Contig Information
Length 827 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1f01   
Homology (BLAST) Top Hit hypothetical protein OsI_20010 [Oryza sativa Indica Group]
Score 331
Evalue 4.36901e-29
Total Hit Count 377
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1f01
ATTCACAGGCAGAGGCCAAAGTTTCGTAGGACCAGGTAATGTAAGTCTGACTGGTCCTCCCACCATAATATTAGGAACAAAGTAGGAGAATCTGGGCAGG
AATATATTACAGGAGAAGCCCCCTCTTTCACATTAACTTGCTAGCATGGGAACCCCAAGTAGCTGCCATCCTTCTCAGCGCTTCAGGCGCAGAGCGTCCT
TGAGCAAGATGGCAGAGTCGCTAGACTGACCGGCTCTCCAGACCCTGAAGTCATCGTCGAAGTACCCTTGCATGTTCCAACCATCCAACAGCTCTAGAGA
GAAGGGGCCTTGCTCGTCACCAAAAGGATCCCTGTAATGCCACATGCCCGACTGCCTTGTCTTGCGTTGCGCCACATGAATATTCCCAGACTCATCGGCA
TCCATATCAACAACAACCACGTTTGCACCTTGATCATGCGTCGGATCATCTTCGTCGTCATCAATGTTGATTACTTCGGCTGGGATGCGAGCGGCATTGC
CTTCAGCACCCTGCTTCTGGACATTTGCTCCCAGTTTATCACCAGCAGCATTCTCTTCACTACCCTGAGTACTCTGGCTTTGGACATTTGTTCTAGGTGT
ATCGCCAGCAGCATTGGGTTTAGTGTCTGCAGTGCCCTGATTTTGAACACACGTTTTCGGTGTATCAGTGTCACCTTCAGTACCTTTAGAATTTTCTTCT
GGACAACTTTTTAAGGATAGGGAAACGGCTCTGCCGTCGTTGGCACCTTCANATTTTTCTTCANAGCACTTTTCANGTAANCAGCTTCCTCATTGGCACC
TTTANAATTTTCTTCCGGGCAACTTTC
page-top