Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1f04
Contig Information
Length 703 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1f04   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 434
Evalue 3.64327e-41
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1f04
AACACACACACACCTATTGCTCCATGAGTTAATGGTGTGATCGATTGAGATCACCCAACACCTTACAGAGCGATGGATTGATAGTACCTACTACTCTAAC
TCTAAAGAAAACTTCCACAAACCCTAACACTAAAGCAAAAACGACAACAAACGGGGACAACAAGAGCCACAGAGGTAAAGCTCAGGAGCTATCTAGCTGT
AGTACTAGTAGTAGTAGTAATATGTATATAGTGTTTGCTCGTGCGTGTGGCATGGCTTGACTGGAACCAGCCGGCGGCAAGAGTAACCGATGGAATGATC
GACGACCTAGTCACCGCGCGGCGGCGCCGCAGACGACGTCGTGCTCGATCTCGGAGACGGCGCCCTCGTCGTCGTCGTCGAAACTGCCATCGCCTCCGGC
GGCGCCGTTGCAACCGAAGGCGCCGTGGCCGTGACCGAAGGCGCGCGCGTGGTCCTTGAGCGAGCGCTTGTGCTTGAACTCGGAGCCGCAGAGGCAGTAC
CAGAGCTTGCCGCAGTTCTTCTCGTGGGTGCGCCAGTCGCCCTTGACGGCGAAGGCCTTGCCGCACCGGCGGCAGAGGAAGGGCTTGAGGCCGTGCTTGC
GCTTGTAGTGCGTCTGCAGGGTGCGGAAGTCCTTGAGCGGCTTGGCCCGTGGATGGTCGATGTTGTTCCGGCNCCCCGCNGCGCNNANTANCACNGCANN
CGC
page-top