Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1f07
Contig Information
Length 785 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1f07   
Homology (BLAST) Top Hit hypothetical protein LOC100190901 [Danio rerio] >gi|166796261|gb|AAI59272.1| Zgc:175035 protein [Danio rerio]
Score 78
Evalue 8.66486
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1f07
AAGCCAAAGCCAAGGAGGACACGACAAGCTAGCCAGCCAGAACCAAGGCAGTGCAGAGGAGGAAGAAATCTGGTCGCCAGATTCTGCAGCTGTACGTGCC
TTCACATGTACATGTACCTGTACCGGTGCAGAATTTTTCTTTTAAGCTAATGTTGGCAGTGATCGCCGACTATTAGCAGATGCAGTGTCTGCAAGCAAGC
AAATCAACTGACTAATCAAGATTTCATACATCCATGGTCACATCAGTCCAGCATTCAGCAGTAACTTCCACTACATGTTGCTGTCTGGGCACCCACAGGT
ACAATTACAATGCCCGAGACTGAGAGACCAGGACAACTCAACCTTGCAAGACCACAACATCACTAGCACTACCTTGTAACTCGACATCTCTTCACATTTC
ATACCAGTCCCAGGCAGAGGCAGCATCATACAGGCATAGGTAGCAATCAATCACATCCTTAGTGGAAGCCTGTCCCTGAACCACAGACACCTTCAGCCCC
TAACCCTATCAACAGCTTTAACAAGCACATCATCTCCCCTACCTATTGATACCAGCTTTACCCAATTGATAACAGCTTTAACCAGCACACTGGGGGGACT
GAAACTGAACCAACAATTTGCAGAGAATTTTGCTCATGCACTTGATGCATTCGTTCGTTCCCTTCATTTCCGTTCCCAGGCCCGGGCGCGGAATCTCGAC
GGAGAGACGGTACTCAATGACGGCTGATGTTGCACTGAGAATCTGTTTATTTACTCACACGCCAGCTTGGTGTCGAAGCNTGGTC
page-top