Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvs1a02
Contig Information
Length 221 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs1a02   
Homology (BLAST) Top Hit hypothetical protein LOC100193040 [Zea mays] >gi|194692230|gb|ACF80199.1| unknown [Zea mays]
Score 132
Evalue 2.93156e-16
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>rwhvs1a02
TCACACNATTTCCNACAGNATGTGCNGATATCTGCTATAGTCCGACGTCNTCTTGAGANTCGGCGTGAGCTCANCAGNAAAGCTCAGCACAGCGGCAAGG
TTCGGCGTGATGTTCTTGGCCACGGCTTCCTCCAAGGAACAGGGAANGCTGCACGGTGATAACCTTGTATTTTCGAGCATANCGTAGAGCCTCCAGGTAG
TACCCGTCTTGGAGTAATGCA
page-top