Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig79
Contig Information
Length 618 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl49h11    rwhfl49h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit REV3 [Neurospora crassa]
Score 96
Evalue 0.0429081
Total Hit Count 42
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig79
tcggtgtgcactgctgtataccggctgcaatggccgcgtttaaccaccacctgcgcttcttcctccttctCGCCCTTGCCGCCAGCAGCATCATCAGCGC
AGGGGCCGCTGCCGGCGACGAGGACGACGTGCAGCTGCGGAAGGTGGCCATGTCGCAGGCCGTGAAAGTGCTGTCCCGCTACAGCCCGGAGACCACCGac
caagGAAACGCTGAAGCGGGCGCTGGCGGTGGTGAACCGGGAGGCACAGCGGTACTGGAAGCCCATCTTCAACAACGTCGACAGGCTGATGGACAGCGGC
GCCGAcggccgcagcaaggaggcggcgttcgccgtggccaaggagctgctcaaccgcgagctcggccaaggccccaacgccgtcaagatcgacttcgaat
atgcgtgacatgcatgcatcgccagtttgccacctctgcctttttttttcgtagggcttttagcgtgccctgtctttgtctgtggtgtgttgttgtgagt
ccttgtgctagctgcggcctgtcgcagttgtctgagccttccacttccgtgtcgacttttagagaaaaggcacaaaggcccgacttcaaattaatgaagc
catcaaccggctaggata
page-top