Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2170
Contig Information
Length 1029 bp
Tissue Seed DPA20
Clones 6 Clones [Download: CSV  ,  FASTA ]
whdp10b10    whdp16h18    rwhdp10b10    rwhdp13c17    rwhdp16h18    rwhdp20p05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 1400
Evalue 6.9218e-153
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2170
AATGAGTAGTCTCAGAAGCTTCCATGTTTTGCCAAAAGCCGAAATTAACACGACAGTACTCAAATGACACATCAACAGGGCGCATATCACACGGCGCTAA
CAGTAGCAAAACTTAATAGGCACTAAACTACTACAGATCTCAAAAGCAGACATAGATGGATTCAGGTAAACGCCTCATTTCTTCTTGATGGCAGCCTTGG
TCACCTTGGCGCCGGTTGGGTCCTTCTTCTCCACACCCTTGATGACACCAACAGCCACAGTTTGCCTCATGTCCCGGACAGCAAAACGACCAAGAGGAGG
GTAAGTAGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTATGCCAGCATCACCATTCTTGAGGAACTTGGGCAGGGCCTCCAGCTCC
TTACCAGATCGCCTGTCGATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGCGAGGTGTGGCAGTCCAGCACTGGGGCATAGCCGTTGCCAATCT
GACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTCAGATC
CTTCACGGCAACATTCTTGACGTTGAAGCCGACGTTGTCACCGGGAAGCGCCTCCAGGAGAGACTCATGGTGCATCTCAACGGACTTGACCTCAGTTGTC
AGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACGT
CCTGGAGGGGAAGACGGAGGGGCTTGTCTGAGGGCCTCTTGGGCTCGTTGATCTGGTCAAGCGCCTCAAGCAGGGTTGGGCCCTTGTACCAGTCAAGGTT
GGTGGACCTCTCAATCATGTTGTCACCCTCGAACCCAGAGATGGGGACGAAGGGAACCTTTTCAGGGTTGTAGCCGACCTTCTTCAGGTAGGAAGAGACC
TCCTTAACAATTTCTTCGTAACGTGCCTT
page-top