Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2137
Contig Information
Length 611 bp
Tissue Seed DPA20
Clones 5 Clones [Download: CSV  ,  FASTA ]
whdp10e01    whdp11i04    whdp20f11    rwhdp10e01    rwhdp20f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0116900 [Oryza sativa (japonica cultivar-group)] >gi|41052832|dbj|BAD07723.1| putative 15.9 kDa subunit of RNA polymerase II [Oryza sativa Japonica Group] >gi|113535214|dbj|BAF07597.1| Os02g0116900 [Oryza sativa (japonica cultivar-group)] >gi|125537811|gb|EAY84206.1| hypothetical protein OsI_05586 [Oryza sativa Indica Group] >gi|125580570|gb|EAZ21501.1| hypothetical protein OsJ_004984 [Oryza sativa (japonica cultivar-group)] >gi|215768240|dbj|BAH00469.1| unnamed protein product [Oryza sativa Japonica Group]
Score 579
Evalue 4.13116e-58
Total Hit Count 157
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2137
GCAGCGGCAGCCGGAGAAGAAGAGATCGAGCGCCAGCAGCCATGTTCCGGCATGGAGGAGGAGGAGAACGCCGCCGAGCTCAAGATCGGCGAAGAGTTCC
TGAAGGCCAAGTGCCTGATGAACTGCGAGGTGGCGATAATCCTGGAGCACAAGTGGGAGCAGCTGCAGCACATGTCGGACGGCGGCGCCGACCAGGTCTC
GCAGGTCTTCGAGAAGTCGCAGGCCTACGTCAAGCGCTTCAGCCGCTACAAGAACCCCGACGCGGTCCGCCAGGTCCGCGAGACGCTCTCCCGCTACAGC
CTCGTCGAGTTCGAGCTCTGCACCCTCGGGAACCTCTGCCCCGACACCGCCGACGAGGCCAAGGCGCTCGTCCCCTCCCTCGTCCCCGGCGGCAGGTTCG
ACAGCGACGACCGGGTCGACAAGATGCTCAACGACCTCTCCCTCATCAAGAAGTTCGAGTAGTAGCCCCCATAATATGCTCTTCTTGTCTTCCTCCAGTG
ATATGTTTAAGCTTCAGATTATCTCCTTTTATTGCGCTATGATCATAAGACATCAGTGTCAGTCTCAAATGAATGGAGTTAATTAAACCTTGTTGCTATG
CTGTCTGGAGA
page-top