Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11f09
Contig Information
Length 849 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11f09   
Homology (BLAST) Top Hit RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine sulfhydrylase; AltName: Full=CSase A; AltName: Full=O-acetylserine (Thiol)-lyase; Short=OAS-TL A >gi|218335|dbj|BAA02438.1| O-acetylserine (thiol) lyase [Triticum aestivum] (no hit)
Score 829
Evalue 8.49601e-87
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whvh11f09
TGATGTATAAGCACAAGATCCAAGCTATAAAGAGCGCAAATTACTTCTTACCACTTTTATAAAGGCTAATTTACTCCATTTAGATTGAGGTAGTTTCAAC
TTATAAACCTCTTGTGACCAATTGGCATATGCTGTTAGATATGAGACAACAATTGCCTCAATGCCTCCAATGTTTTGGGCATTTTTTTCTTTGCATTTTG
AATCATAAGATGGAGCTAAAAAAGAAGCAAATTTGTCAGACTGCCGGGTAAAAAGGGAGCTAAATGTTAAACACTGCCATGTAAAAATGAACCTTTGGAT
TCTGGGATGCACTCGTTGCGCCGATGGCGCAAAGGGCGAGAGAAAACTATGTTTTCAAAGCATGCAAATAAGAATATTTAGAGACTGATCATAAAATCCT
TGAAGCATAAGGGAATAGATATTTTGGTATGCTGCTCATACATAGCGTTATATATTACATTGCATGGTAGGTTCATAGGACAAAAGAAAGGCATGAGATA
TGTTCATGATAAGCAAAGCTACATAGGCAGAGATGCACCATATAGATAGCTTTGATCGCTCAGCTTACGGTAACCAGGATATGCAGTCATTTACATTAGG
TAGTGCATAATTTAACTGTACGCCCACAATTGCTATTGCCAGCAAACAAGTTTCTGATTTCTCGCACTAACAGTTCTCACGATACTTATACAGGGTGAAG
AATATGAGCATCCGGAGTATATCATTTGCAGTGAGCCAATGCCAGGCTATAATGCTTATTATCCTGTTCTGATATTCTTCATTTAAAATAAAATGACCTC
ATAGTGTTTATGATCTGCTATACTTCTCCGACGCCAATTTTCCGCCTTA
page-top