Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh10a06
Contig Information
Length 862 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh10a06   
Homology (BLAST) Top Hit RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine sulfhydrylase; AltName: Full=CSase A; AltName: Full=O-acetylserine (Thiol)-lyase; Short=OAS-TL A >gi|218335|dbj|BAA02438.1| O-acetylserine (thiol) lyase [Triticum aestivum]
Score 829
Evalue 8.49601e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh10a06
CAAGATTCAGACATGTATGGCACCATGNATGCTTTCATTTCACACTGGCTGACATATGGACCACAGAGGAGTTCAATATACAGGGCATGCAAGAGGTAAT
TCAAATCGCTAAACACCACAAGGCCAACACAAAAGTATTCCCCATTGCTAAACAAAGTGGGATTAAAACTTGACAGGACTTGATGTCAGACCAACACTAG
CAGGGACGCCAAAGCTTTTATTTCTGTAGGAGGGCTCCTACGAATGTAGGGATTTGGCTTTGGAGAACAGCTTCGCGCGCTTGAGGAGTCCCGAGAGTCA
CTCGACCACCATGCTCTCGGCCTCCTTCTTGATGGAGTGGAAGAGCACCGACGAAAGGTAGCGCTCTCCGAAGCTTGGGAATACAACAACAAAGAGTTTC
CCTGCATTTTCAGGCCTCTGAGCAACCTTGATTGCAGCTGCTGCAGCAGCACCAGAAGAGATTCCAACCAGCAATCCTTCTTTCAATGCCAGAGACTTTG
CCATCTCAATGGACTCATCACTTGAAACCTGTATGGTTTCATCAATGATGTCAACATCCAAGACACCAGGGATAAAACCAGCTCCAATTCCTTGGATCTT
GTGTGGTCCAGGCTTTCCACCATTTAAGATAGCACTCTCGGTAGGCTCCACACCGTAGAGCTTGATGTTAGGATTTTGCTCTTGGAGGTATTTTCCAGTT
CCAGTAATGGTACCACCTGTCCCGATGCCAGAAACAAGGCCATCGATCTTTCCTCCTGTGCCTTTCCAGATTTCAGGCCCAGTTGTCTCATAATGAATCT
TTGGGTTGGCAGCATTCTCAAACTGCTGAAGGATGTATGANTTGGGTGTCTTTGCTGCCANC
page-top