Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11f05
Contig Information
Length 281 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11f05   
Homology (BLAST) Top Hit hypothetical protein OsI_11150 [Oryza sativa Indica Group]
Score 78
Evalue 2.67019
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>whvh11f05
GGCTGATGCTATACAACGAATCTCATCCAAATCGACTAATGTAGACTCAGTCCGCATGGACGCCAGAATTTGTGAGGTCGATATCGCCCATTCCTGTATA
GCATCAGCCAAGTTCCTAAATTATCCTATTTAAAAGCTCTTTGAATTCGCTGGTAGTGTCATCTTGGATGTTCATCGGCCTGTGCTGGGCTTTACTTTGA
TTGAGCAGCACCTGTTTTTTTCTTCTCTTTGGAGTGAAACATAGTTTTGTTGTTCTAAACAAGTGTTTTTGAAAAAAAAAA
page-top