Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh10a19
Contig Information
Length 814 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh10a19   
Homology (BLAST) Top Hit vacuolar protein-sorting protein 33 [Zea mays]
Score 659
Evalue 3.89979e-67
Total Hit Count 193
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh10a19
CCACTTGATGTACAAGGGTGAAAGCAGAACAGAGTTAGAAATGAAGGTGTGTATTTCGAGAATATACATGAAAAAACATAATGCTGAACTTCCATCCAGC
ACCAAGGAAGGAACTAGCGCGGCTGTGTCTGTACAGGAGATATCGATGTACATGCGCTATCTGACGAGAAAACCAAGGCTGATGAACGCAAGAGCGCAAG
CAATAGCATTTCCGGTGGCAGAATAGAAGTAGCCTAGAACTGAACCAAGGAAAATCCCATCTTGGGCTCGGGTGTGCGCTGCTTTGTACAATCAAAAAGG
GGTGTGCACAGAAAAGACAACTAAATCATTCCCTCTTTGCTGCTGGCTATAATTGGTCTCAGTAATGTGTTGCCAGTGATAACCTTTGTTGTTGCAACCA
GGAAGTCATAGCCCATTCCTTCCTGTGCACTAAGAAATCGAAGCGCAGCAATCTCAGCAGATGTTACACCACCAATAAATACAACCAGAACCAGGGAGCG
ATGACCAACCCTGTCGGTACTCTGTTGTGACCCGGAACCTGGTAGTAATTCTGATGAACTAATGGTCGAGACACCTCTTTTCAAATCCATATGAGGACCT
GGCAATAATTTCAACAGTTCTTCAATAGATCGCCATCCAGACCTCACTGCATGCTGAACCANGCGAATACTAAGAGGTGCATATCCAGCAAAGATGTATG
CTATATCATCAGGGTTTTCAGGATCCTTTATATCAACTATAANCTGGANAGCTCTACTAATAACAGGCCAATTANTCCTCGATTCCTGCCTTTTAACAAG
GCCAGCTTTTTCCA
page-top