Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11f02
Contig Information
Length 849 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11f02   
Homology (BLAST) Top Hit hypothetical protein OsJ_022807 [Oryza sativa (japonica cultivar-group)]
Score 305
Evalue 4.74409e-26
Total Hit Count 223
Registered year 2003
Contig Sequence     [ Download ]
>whvh11f02
TCGCCGCCGCCCCCCTCCCACCACACCCCAGGTAACCCTAGTTCCCAAATCCTTCTTGGATCCAGCCAGCCATGGCGGGATCTTTGATGATGTCCGGCTC
CTTCGACCCCCCTGCCGCCGATCCCGCCGGCGCCAACCCCTCCCGCTACCCCTTCTGGGTTCTCCTCGACAGCACAGCCTACTTCGCCAACCGCGACAAC
GCCACCACCGTGAAGGGCACGACGAGCGCGGGCCACGAATTCAAGGTGACCTTCTGCCTCGCTGACCCGCCTGCCGTCTCTTACTTCTGCGTCCACTTTA
CCGGAGTCAGCATACAAGAGCTTTGCACCACGGAGCCCCGCGTCGTCTCCTCCACCTATGACCTCGCCCTCCTCTGCTTCCCCATCAGAACCGCCCTCGA
GTACTTTGTCTACAAGGCCTTCTCCGGCGGCAAGAGCATCATCCAAAGGGTCCCTCCTTCTCCAGCATACAAGCACCAGTGGCTCTCGGCAGTCGTGCCA
CGCGAGGGCGACAATTTCTTGGTCGCTGATCTTTCCCCGGGTGGGGACCTTGGGCACTACAACCTGCATATCTTCTCATCGGAGACGAAAGAGTGGAGCA
CAAAACACCTACAGCTGCAGGCGCCCTCTGATGTCCTGTCACGGGACCTGCCAAGCCAAACCGACAAGGTGATCTTTCTCGGAGCAAACACTGTTGGATG
GGTCGATCTCTGGCGCGGCATCGTTGTGTGTGATGTGCTCCAGAAGGATCCTGTTCTCCGATTCCTCCCGCTGCCCAAGGCTGATTTCGACCTGCACCGG
GAAAGTCCAGCACGGCAAGTGCGGGACGTCATTGGCTTCCCTGATGGTT
page-top