Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh19k07
Contig Information
Length 429 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh19k07   
Homology (BLAST) Top Hit Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|21104591|dbj|BAB93184.1| unknown protein [Oryza sativa Japonica Group] >gi|113534192|dbj|BAF06575.1| Os01g0823600 [Oryza sativa (japonica cultivar-group)] >gi|125528208|gb|EAY76322.1| hypothetical protein OsI_04255 [Oryza sativa Indica Group] >gi|125572471|gb|EAZ13986.1| hypothetical protein OsJ_003811 [Oryza sativa (japonica cultivar-group)]
Score 354
Evalue 2.67797e-32
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>whvh19k07
CTGCTGTATGAGGCCAGGGATTCCATCAAAGATGAAGGAAGGATGACAAGGGAACAGTATGCAGCCCTTCGGAGGAAGATTGGTGGCACCTACAAGGATT
TCTTCAAGTCATATGTTGAAGTTGACGGTGAATACGTGGAGGAAGGTTGGGTGGACAAGACCTGCAAAGTTTGCAAGAAAGACACAAGAGGGGAGCCAAG
GCAAGTTGACAATCTAGGAAGATATATGCATGTGGCGTGCGCAGAGAACTCGAAACCAACAAACTTCTTTTCCAAGCTCTTCGGCAGATGAACTTCTTTT
GTACCATCAAACCCGTTGTTCGACTCATGGTTAGATAAATAGATGGATGCTATAACACCAAGGGATTAGGACAGTAATGTGTACTGTGTTGTTCATGTGA
AATGGTTTTTGATGAGCATAAAAAAAAAA
page-top