Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh19l04
Contig Information
Length 798 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh19l04   
Homology (BLAST) Top Hit hypothetical protein OsJ_015857 [Oryza sativa (japonica cultivar-group)]
Score 815
Evalue 3.09735e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh19l04
GAGCTTTACACGGATGAAGGGTCTGATTTCAAGTAATGGCTCGAGTGAGCGGGCGTCGACAGAGTACATCCCCTTATTTATCAAGAAGAATTCAACAGGC
AAGGGTTTGCAGTACAACCAAGCCAGCAGCTTCCCGGCATCACTGTCCCTCTCCAACAACTTGCTTGCTGGGCCGGTATTGCCGGGATTTGGTCATCTTG
TGAAGCTTCATGTACTGGACCTCAGCTGGAACAACTTCTCGGGGCGAATTCCCGATGAGTTGTCAGACATGTCGAGCTTGGAAAAGTTGAAGTTGGCTCA
CAATGATCTCAGTGGGAGCATACCGTCATCTCTGACAAAGCTCAATTTCCTCTCCGACTTTGATGTGTCATACAATAATTTGACTGGAGATATCCCAACC
GGGGGCCAGTTTTTGACATTCGCGAATGAAGGCTTTCTGGGCAATCCTGCGCTCTGCCTCCTTCGGAATGCCTCCTGCTCCGAGAAGGCTCGAGTTGTGG
AAGCAGCACACCGTAAGAAGAGCAAAGCCAGCCTTGCTGCAGTTGGAGTAGGAACTGCAGTCGGGGTTATCTTTGTCTTGTGGATTACTTATGTGATTTT
GGCAAGGGTTGTCCGTTCAAGAATGCACGAGTGCAATCCAAAGGCGGTTGCTAATGCTGAAGACTCCTCCTCAGGGTCTGCTAACTCAAGCTTGGTGCTG
CTATTCCAGAACAATAAAGATCTCAGCATCGAGGACATCTTGAAGTCCACGAACCACTTTGATCAAGCATACATAGTTGGATGTGGTGGGTTTTGGNC
page-top