Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh6b09
Contig Information
Length 764 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh6b09   
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 885
Evalue 2.17037e-93
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh6b09
GTATGATCTAGTTTAACATCTGTTACATCACCACAACCATCATCAAAACCATAGTCTCAGTAGCACCACATACAAACAACAACATAGTAAGGAAGACACA
TAGGGAGAAAAATACCGCGCCTCCCTTCACAGCAAGAGCCAGTACCAAAACATGGCCCCAAAATTTAGAGCTTGTCCTCGAAGCCCCAAAATTTAGAGCT
TGTCCTCGAAGTCGGATAGGGGGGTCATCTGCTCCTTGAGACCCTTCCTCTTGCGGATCTCCGTCACGAGCGTCGCCGACTGGGTGCCAGGGTCCAAAGG
ATCGGAGGCCATGACGTCCCAGTGGTCAAACACACACTGGGGGAAGGCCTGGCCGGACGTCGCGGCCCTCAGGGTGCTCGAGAACCCGAAGGACTCGATA
ACAGGCAGGTAGGCCTTGATGTTGTAGAGTGGGGTACCTTGCCTCTGCATCTCCTCGAACACGTGGCCTCTCTTCTGATTCAGCACACCATAGATACCAC
CAAGTGCGTTCTCCGGGGCCTGGATCTCAACCAGGTACACGGGCTCCAGCAGCCTTGGCTTGGCAGTGAGCTGAGAAGCGTAAATGACCCTCCTCGCCGT
TGGGATAACCTGACCACCACCCCTGTGAATANCATCAGTGTGGAGAACAACATCACAGACCTCATANCANATACCACGCATGTTCTCCTCACACAATGCT
CCTTCTTTTGATGCCCACTGGAACCCANCCACAACANAGTCCTTGATTTCATTCANATACTGCA
page-top