Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh19p21
Contig Information
Length 808 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh19p21   
Homology (BLAST) Top Hit Os01g0616900 [Oryza sativa (japonica cultivar-group)] >gi|113533112|dbj|BAF05495.1| Os01g0616900 [Oryza sativa (japonica cultivar-group)]
Score 829
Evalue 7.50297e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh19p21
TCTCGTGACGGCTGCGCGCTTGAACCCCCACCCCGCACACACTCGCGCCGGACCGGACGAATCGCGGCGGCGGAGGGCTGAGGCGTTGGCGGACGAGAGG
AGGGGCGGAGAGAGAGAGAGAGGCGCCCCGGCGAGATGAAGTACGTCCTGGTGACCGGCGGCGTGGTGAGCGGCCTCGGGAAGGGGGTGACGGCCAGCAG
CATCGGCGTCGTGCTCAAGGCCTGCGGCCTCCGCATTACCTCCATCAAGATCGATCCTTACCTTAACACTGATGCTGGAACCATGTCTCCTTTTGAACAT
GGCGAAGTGTTTGTTCTANATGATGGTGGCGAGGTGGATTTGGATCTCGGAAACTATGAGAGGTTTCTAGACATTAAGCTGACACGTGACAACAACATAA
CTACTGGAAAGATCTACCAGTCTGTTATTAATAAAGAAAGAGAGGGAGAATACCTGGGAAAGACTGTGCAGGTTGTCCCACACATTACAAATGCTATACA
AGATTGGATTGAGCGTGTTGCAATGGTTCCTGTTGATGGCCAGGAGGGACCTGCCGATGTCTGTGTTATAGAACTGGGTGGCACTATAGGGGATATTGAA
TCCATGCCATTTATTGAAGCTCTAGGTCAATTCTCCTATCGTGTTGGTGCTGGTAATTTCTGTTTGGTACATGTCAGTCTGGTTCCGGTATTGAATGTTG
TCGGTGAGCANAAAACTAAGCCAACTCAACACAGTGTACGTGGTCTGAGAGGACTTGGTCTCACNCCAAATATGCTANCTTGTCGCANTACTAANGAGCT
AGAGGAAA
page-top