Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh6b02
Contig Information
Length 808 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh6b02   
Homology (BLAST) Top Hit respiratory burst oxidase-like protein J [Hordeum vulgare subsp. vulgare]
Score 545
Evalue 7.24113e-79
Total Hit Count 449
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh6b02
ATACAGATATTTCTAAATATTCCAGTCTATGTATGCTGGTGACACTAGCTTTCAATGTACTTTGTACAACCCAGCGTACAACAAAATTTGTAAAGCTATA
TTTACTATTCGAGCACTATCATATTTCTTTTCCTATACAAGTATATCTTCCAACTGTTTGAAATTCTTCGGGTATGGCCTTAGAAATTTTCCTTGTGGAA
ATGAAACCTAGTTGTGGTTGTCTGGCTGAATTCTTTTGAAAGATCCTTGAGTTGTTTCGTGAGTGTTGGAGATCCACAATAGAAAACACCTATACGAGAG
TTCTTGTGGGCATTGGCCAAATCAGAGAACACTTTTCTCCAGTTAGGCCTTGCAAAATGTGTCCGAATCTTGCTTCCGGAGACGATGTCAACACCATTTT
TGGCATGCTGGAGTGACTGAACCATGGCAATCAGCGCTGACCTTGCGTCGCCTTCTTCATACACGCTGGTGAGGTAATTGTGCATCTCTATGACATCCTG
CAATTGCCATATTACTTTAGCCCAGTTTTATAGATGCGACTAGACATTTTGTATCGTATGGAAAGATGAAATTGAAAATATCAGAGTGAGATAAGTACGC
TGTGATCGTTGTCAGCGACTTCATTCATGACTCCTTTGAACCAGTCGAAGGATCCTTGCTCTCTGGTAACCCAGTAGAAGTAAGCTCTCCCTGGCCCACT
GTTCTTGAAGCTGCCTATCTCAGAACCGTGTATACTTTCCACCTCCTGTTCCATCAACTCATTTTCTCANNTATGCTATCTCCATTANCNATATTATTAT
GNATATAA
page-top