Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh20a17
Contig Information
Length 237 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh20a17   
Homology (BLAST) Top Hit cell wall beta-glucosidase [Secale cereale]
Score 176
Evalue 1.17265e-11
Total Hit Count 110
Registered year 2003
Contig Sequence     [ Download ]
>whvh20a17
GGTTCAAGTCGGTGGACCAGCTGCCGATGAACGTCGGCGACAAGCACTACGACCCGCTCTTCCCCTTCGGGTTCGGCCTCACCACCGAGGCCAACAAGTG
AGTCGGGTACTCGGGTGAGATGGGATGTACTATCTCGGCTGGGCTGTGAGAGATGGGATACATACATACATTGAGTTTTGTGGTTGATTTGTTATGTTAG
CAATAAAAGAGCGATGCGTTCTTGCGGAAAAAAAAAA
page-top