Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh20k06
Contig Information
Length 782 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh20k06   
Homology (BLAST) Top Hit hypothetical protein OsI_02907 [Oryza sativa Indica Group]
Score 1016
Evalue 1.46915e-108
Total Hit Count 279
Registered year 2003
Contig Sequence     [ Download ]
>whvh20k06
ATAGCAAAGTAAGCTCTGCCACAGCTTGTGCAATGTCTCCATGCTCGCTAAAGGAGGCTGATGAGGAGTCATCTGTTGATCTTAGCTTGAATTTTGAGCT
TTCCCTTGGCAATGATGTTGCACACTTCCAAAGGAAATCCTCTGCTGCTTTGGTGGCCAAATCTCCTAAACTGGATCTTCAGTTGAGTTTATCCACTGGC
TCACCTGAATCTGCTGTCACTTGTACAAATATGGTGTCACCAAATATTCATGATGGCTTGGACATACCAGTGACCTATTCATTACCAGCCATTATAGGGA
ATGGGTCAGCACCGTCTAGTTGGGGTTTTGAGCACTCTGTGGTTTCATCATCATATGCGTCTGAAGCAACATATGCCTTTCCATTTTCGAAGATACCCAG
ACAAGAGAATGGTGCTTTAGCTTCGCCAGTCATATCGTCAACTATGCCAGCAAGTGTGAAGAGCTCGGTTGCCTCTACTTCGGTGGTAACTAACCCTCAG
CAGCGCAATCTTAACACTAAAACCTGCCAGTTCCCTGGATGTGGGAAAGGGGCAAGAGGTGCATCAGGGCATTGCATAGCCCATGGTGGTGGCAGGCGAT
GCCAGAAACCTGGTTGCCAGAAGGGTGCTGAAGGAAGGACCATATATTGCAAGGCCCATGGTGGAGGGAGGAGATGTGAGTTTCTTGGATGTACAAAGAG
CGCTGAAGGGCGCACCGACCACTGCATTGCCCATGGCGGTGGCCGCCGGTGCAGTAATGATGGCTGCTCCCGTGCTGCCCGA
page-top