Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvh17j17
Contig Information
Length 488 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvh17j17   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605604|gb|ACG24632.1| 40S ribosomal protein S24 [Zea mays] >gi|195657831|gb|ACG48383.1| 40S ribosomal protein S24 [Zea mays]
Score 584
Evalue 5.78389e-59
Total Hit Count 360
Registered year 2003
Contig Sequence     [ Download ]
>rwhvh17j17
AGGCTGATAGGNAAAAGATGAAGACAGAAATGNTCTTATTTCTTCTTGNCATCTCCGGCCTTGGTCTTCTTCACACCACGGATCTTCTTTGTCCTGTTCT
TCCTTTCCTTGATCTGCTTGCGTGACTTCTCTACCTTGGTAGCAAGGCCATTCCTGATGAGGCGGGACTTGGGCTCGAACTTCTTGGCGGACTCGAGGTT
GTCGTAGATGAGACCGAATCCGGAGGACTTGCCGCCTCCGAAGTGGGTGCGGAACTTGAAGACGAAGATGCAGTTGGGGTCCTTCACCTCGTACACCTTG
GCGAGCCTCTCCTTCAGCTCCGCCTTGGAGACGTTGGCGCGGCCCGGGTGGATGACCTCGAGCACNAACTGCTTACGGGCGAGCAGGCGGTTGGTCATGA
ACTTGCGGGTGCGGAGGGTGACCGCCGTCATGGCCTTGGCGTCTGCCATGGCTGATTCNACCTCNCTTCNCGGNGGGCTGCCTGCNNA
page-top