Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh20k24
Contig Information
Length 416 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh20k24   
Homology (BLAST) Top Hit hypothetical protein ACTODO_01927 [Actinomyces odontolyticus ATCC 17982] >gi|153799030|gb|EDN81450.1| hypothetical protein ACTODO_01927 [Actinomyces odontolyticus ATCC 17982]
Score 77
Evalue 3.48994
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>whvh20k24
GGTGTTTCAGGCCGTTCTGCTGCTTTGTTCGGTGTATCTGGTCGGCCTCGCTTCGATCGTTCAATCTAGAGGCGTCGCCGCCGCGGACGGCAGAGGCATG
ATCCTGGTCGGACCCTTCGTCTTCAACGTCGGGGACGTGGGTGAGGAAGACGTCGGTGCCGCGGACGGTGGCGGTGTGTGTGGTCTGGATCGGACTGTTG
GTTTTGATCTGACGGCTTAAACAGACCAGTTAGATCTATTAGTTTAACAGAAAAAAAAGGAGAAAGATAACGTTAATGAAAAGGCCCCACGCACCAACGT
ACGTGAGGTTTTTATCTCAACTAAGGCGCCCTGATCGGGGGCACCCAAACCAACTGATGGTTTANGTCCCCTGTCGCCAGCCCTACATAAAAGGGAACGG
GAGAGGGTTGGCANCC
page-top