Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11d09
Contig Information
Length 827 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11d09   
Homology (BLAST) Top Hit hypothetical protein OsI_15716 [Oryza sativa Indica Group]
Score 1339
Evalue 5.703e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh11d09
ACACTTCGATGAGTACAGGAAACATATCGAGAAAGATCCTGCTTTGGAGCGAAGGTTTCAACCAGTCAAGGTACCAGAGCCCACTGTTGAAGAATCAATA
CAAATCTTAAGAGGACTTCGTGAGAGATATGAACTTCATCATAAGCTGCGATACACAGATGATGCTTTAGTTGCCGCGGCGCAGTTATCATATCAGTATA
TCAGTGACCGCTTCCTGCCTGACAAGGCTATTGACTTGATTGATGAAGCGGGGTCCCGTGTTAGGCTCAGGCATGCACAGCTACCTGATGAGGCCAAGGA
GCTGGACAAAAAACTTCGCCAAATAACAAAGGACAAGAATGAGGCTGTGCGTGGCCAAGATTTTGAGAAGGCTGGGGAATTAAGAGACGAGGAAATGGAG
CTGAAGGCCCAAATTACAGCCATTATTGACAAGAGCAAGGAAATGGTTAAAGCAGAGACTGAATCCGGCGAAGTTGGTCCTCTTGTCACCGAGGCAGATA
TTCAGCACATCGTCTCATCATGGACTGGTATACCTGTGGAGAAAGTCTCATCTGATGAGTCTGACCGCCTCCTTAAGATGGAAGAGACACTCCATACGCG
CATCATTGGGCAGGATGAAGCTGTCAAAGCTATTAGCCGTGCTATCCGCCGTGCTCGTGTTGGCCTCAAGAATCCAAATCGACCCATTGCTAGCTTCATA
TTCTCTGGACCAACTGGTGTTGGTAAATCAGAATTAGCAAAGGCTCTGGCATCCTACTACTTTGGCTCANAGGAAGCCATGATCAGATTAGATATGAGTG
AGTTCATGGAGAGACATACAGTGTCCA
page-top