Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11d02
Contig Information
Length 752 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11d02   
Homology (BLAST) Top Hit hypothetical protein OsI_06722 [Oryza sativa Indica Group]
Score 1047
Evalue 3.44416e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh11d02
GTCTGACTTATACAGNTTGATTCTTGTAGGTACCAGGTGTTACTGATATTCAACTCAAACCTAGGAACATAAGAAAAGTTGCTGTTATTGGTGGTGGTCT
TATGGGTTCTGGAATTGCAACAGCCCTTCTTGTTGGCAATATATCTGTTGTCCTCAAGGAAGTAAACCCTCAATTTTTGCAAAGGGGACAAAAAACAATA
GCAGGAAATCTGGAGGGCCTTGTCAAAAGAGGCTCATTGACCAAGGATAAAATGAGCAAGGCCATATCACTTCTCAAGGGTGCATTGGATTATTCAGATT
TCAAGGATGTTGATATGGTTATTGAGGCTGTTATTGAGAAGGTTCCTTTGAAGCAATCAATTTTTGCTGACATTGAGAAAATCTGCCCACCACATTGCAT
ACTTGCAACGAACACTTCCACCATCGATTTGAATGTTATTGGCGAGAAGACAAATTCTCAAGATAGAATTATTGGGGCTCATTTTTTCAGCCCTGCTCAT
ATTATGCCCTTGCTTGAAATTGTCCGGACGGAAAAGACATCACCACAAGCTATCCTTGATCTCATTACAGTTGGGAAAATAATAAAGAAAATCCCCGTTG
TTGTTGGCAACTGCACAGGCTTTGCAGTAAATCGTACATTTTTCCCTTACACACAAGGTGCTCAGCTTCTAGTTAGTCTTGGCATTGATCTTTTCAGAAT
TGATCGAATAATAAGCAACTTTGGGCATGCCAATGGGACCTTTTCAACTCCA
page-top