Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh8a09
Contig Information
Length 782 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh8a09   
Homology (BLAST) Top Hit Os04g0439100 [Oryza sativa (japonica cultivar-group)] >gi|113564438|dbj|BAF14781.1| Os04g0439100 [Oryza sativa (japonica cultivar-group)]
Score 923
Evalue 8.93372e-98
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>whvh8a09
AGGCAGCCATCTCTTGATGCTGCTGAATCATCTAGTTGCCAGAAGTCTTATGATGTTGCCAGTCAAAGTAAATTCAAGACTCAGTTGGTTAATTTTGACA
AAGCGTGGTGCACCTATCTTTACGGATTTGTGGTGTGGAAAGTAAAAGATGCAAGATCATTGGAGGGTGATCTTGTTAGGGCTGCATGCAAGCTTGAGCT
GTCAATGATGCAAACATGCAAGTTAGCTGCCGACGGGCAGTCACACAACCTCACCCATGATATGAAGGCGATTCAGAAGCAGGTTTCTGACGATCAAAAA
CTCCTAAGAGAGAAGGTTCAGCATTTGAGCGGTGATGCAGGCATCGAGCGTATGGACTCTGCTCTCTCCGATGCAAGATCAAAGTTCTTTGAAGCGAAGG
AGAATGGAAGTCCATTGGCAGCACCTGTTGCAAACGTATCTACCCCTCTGAGCATTGATTCATCTGGAAAGCTCCCGCCTACTGAGGTCAATATGAATTC
CAAAACAGATGCTGAAGGATCAAGGTCTGTTGTGCGATCCCTGTTTGGAGCTTCTGGAGCATCAAGCAGCACATCACCAGTGAATCTGCCAACAGAGAAT
GAGCAGATGGTCAATGAGATGCTTCATGAGGACGGTGGTGCGATTGCTGGCAATTCTAATGATGCTCGTACCATTGAGAAGGGTTTCCAAGACAAAGTGA
GGGAAACAATGGAGAAAGCTTTCTGGGATGTGGTTACCGACTCGATGAGAGGAGACAAACCTGACTACAGCCAACTGATCAA
page-top