Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh11c21
Contig Information
Length 456 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh11c21   
Homology (BLAST) Top Hit RecName: Full=Heat shock protein 82 >gi|7546186|gb|AAB26482.2| heat shock protein HSP82 [Zea mays]
Score 469
Evalue 2.21052e-51
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh11c21
GCGTTCGAGGGCCTCTGCAAGACCATCAAGGACATCCTCGGCGACAAGGTGGAGAAGGTCGTTGTATCCTNACCGCATCGTGGACTCGCCGTGCTGCCTG
GTGACCGGNGANTACGGGTGGACGGCCAACATGGAGCGGATCATGAAGGNGCANGNCCTGCGGGACAGCAGCATGGNCGCCTACATGTCGAGCAAGAAGA
CGATGGANATCAACCCGNAGAACGGCATCATGGAGGAGCTCCNCAAGCGCGCCGACGCCGACAGGAACGACAANTCCGTCAAGGACCTGGTGATGCTGCT
GTTCGAGACGGCGCTGCTCACCTCCGGGTTCATCCTGGACGACCCCAACNCCTTCTCCGCCAGGATCCACCGCATGCTCAAGCTCGNGCTCAACATCGAC
GATTCCGCCGATGGNNCNGAGGAGGAGGACNCCNACATGGTGGCGCTGGAGGAGGA
page-top