Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh20j15
Contig Information
Length 837 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh20j15   
Homology (BLAST) Top Hit acyl-peptide hydrolase-like [Zea mays]
Score 1177
Evalue 1.39236e-130
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>whvh20j15
CTGTCCAGATAGTGTTGTTGTTTTCTCAAACTACAAGGATCAACGCCTGTACAAACAACCAATCGGAACTGGTAGTCTGCCTGTGCCTCTTACACCCGAT
TATGGTGCACCTGATGTCAGTTATGCTGATGGTGTCTTTGACCCACACTTCAGCCGTTATATTACTGTGATGGAAGACCGGCGAACGAGTAGCTTGAATC
CCGCTACAACAATTGTGTCTATAAACTTAAGCAATGGTGATGTCCATGAACCGAAGGTGCTGATCAGTGGGAATGACTTCTATGCTTCTCCTCGAATTGA
TCCAACTAAAAAGAGGATGGCATGGATTGAGTGGGGTCACCCAAACATGCCATGGGATAAATCAGAACTCTGGGTTGGCTACTTCTCTGAAAGCGGAGAC
TTGACCGAACGGGTCTGTGTTGCTGGAAGCAATCCGATGTTGGTGGAATCCCCTGCTGAGCCTAAATGGTCACCAAAAGGAGAACTGTTTTTCGTAACTG
ACAGAGGGAGCGGATTCTGGAACATTTATAAATGGGTTGAACACACCAATGAGGTTGTTCCGATGTACGCATTAGATGCTGAGTTCACAAGACCATTGTG
GGTTTTTGGCATCAACTCTTACGATTTTCTAGGAAAAAGCAATCACATCGTTTTCACTTACAGGCAGCTCGGAAAATCATATATTGGTGTTCTAGATTGT
GATTCAGGTTCTGTTTCGTTGCTCGACATCCCTTTCTCCGATTTGTCCAATGTTGTTACTGGAAAATGATTACTTCTATATTGAAGGTGCATCTGGAAGC
ATCCCCACNTCAATTGGCAAAGGTTACTCTGGATGGG
page-top