Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvh20g03
Contig Information
Length 784 bp
Tissue Shoot with heat shock treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvh20g03   
Homology (BLAST) Top Hit HSP70
Score 1037
Evalue 5.43697e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvh20g03
GGCCGAGAGGAGGAGGAAGAAGGCTCCGGGAAGCCCGAGAAGAGGCGAGGAGGAGAGGAGAGGGATCGCGTTGCGCGTCGTCGTGGCGATGGATCGGGTC
CGCGGCTCCGCGCTGCTGCTCGGCGTCCTGCTCGCAGGATCACTGTTTGCACTTTGTGCTGCAAAGGAGGAGGCCAAGAAGCTCGGTACCGTGATCGGTA
TCGATCTCGGTACCACCTACTCATGTGTTGGTGTGTACAAGAACGGTCATGTCGAGATTATCGCCAATGACCAGGGTAACCGTATCACGCCCTCATGGGT
TGGGTTCACCGATGGGGAGAGGCTCATCGGTGAGGCTGCCAAGAATCAGGCGGCTGTCAACCCTGAGAGGACCGTCTTTGACGTCAAGCGTCTCATTGGG
AGAAAGTTTGAGGACAAGGAGGTGCAGAGGGACATGAAACTTGTCCCCTACAAGATTGTGAACAAGGAGGGGAAGCCTTACATTCAGGTCAAGATCAAGG
ATGGAGAGACCAAGGTCTTCAGCCCTGAGGAGATCAGTGCTATGATTCTTGGAAAGATGAAGGAGACTGCTGAGGCATACCTTGGCAAGAAAATCAATGA
CGCCGTCGTCACTGTTCCTGCGTACTTCAATGATGCACAGAGACAGGCGACCAAGGATGCTGGAGTGATTGCTGGCCTCAATGTGGCTAGGATCATCAAT
GAGCCCACTGCTGCTGCTATTGCCTATGGTTTGGACAAGAGGGGTGGCGAGAAGAACATCCTGGTGTTTGACCTGGGTGGTGGT
page-top